Skip to content

Repository files navigation

ipcr — fast in-silico PCR toolkit (primers, probes, nested & multiplex)

CI DOI Anaconda-Server Badge install with bioconda Go License: MIT

ipcr is a fast, streaming, IUPAC-aware in-silico PCR toolkit for large (including .gzipped) references. It finds amplicons from primer pairs under a mismatch model with a 3′ terminal window, supports internal probes, nested PCR, multiplex panels, circular templates, and emits TSV, FASTA, JSON, or JSONL.

ipcr-thermo provides nearest-neighbor-informed ranking with explicit approximation metadata. It is a thermodynamically informed in-silico PCR ranker, not a complete PCR kinetics simulator. See Thermodynamic models, score profiles, and release claims.


  • Fast & parallel: multi-threaded seeded scanner with per-hit verification.
  • Streaming: rolling chunked FASTA with safe overlap.
  • IUPAC-aware: primer ambiguity codes; genome N is a hard mismatch to avoid spurious hits.
  • Pretty mode: readable ASCII alignment blocks.
  • Deterministic: --sort gives stable order; JSON/JSONL use versioned, stable wire schemas.
  • Good UX: cancelable I/O (Ctrl-C → exit 130), consistent warnings (gated by --quiet), clear validation errors.
  • Transparent thermo modes: NN models, score profiles, salt/DNTp conditions, IUPAC expansion, structure, and probe terms are exposed as output metadata when enabled.

Binaries (CLIs)

Binary Description Common use
ipcr Standard in-silico PCR general PCR
ipcr-probe ipcr + internal probe annotation & filtering qPCR/TaqMan-style assays
ipcr-nested Nested PCR: outer amplicon + inner scan Two-round/nested assays
ipcr-multiplex Panels from TSV or pooled inline primers Screens / large panels
ipcr-thermo Thermodynamically informed scoring & ranking Ranking / assay robustness

Quick start

Standard PCR

# PCR with standard 27F and 1492R primers.
ipcr \
  --forward AGAGTTTGATCMTGGCTCAG --reverse TACGGYTACCTTGTTAYGACTT \
  --circular \
  --pretty \
  Escherichia-coli.fna.gz
source_file     sequence_id     experiment_id   start   end     length  type    fwd_mm  rev_mm  fwd_mm_i        rev_mm_i
Escherichia-coli.fna.gz   NC_000913.3     manual  223777  225283  1506    forward 0       0
# 5'-AGAGTTTGATCMTGGCTCAG-3'
#    |||||||||||¦||||||||-->
# 5'-AGAGTTTGATCATGGCTCAG.................................................................................................-3' # (+)
# 3'-...............................................................................................ATGCCAATGGAACAATGCTGAA-5' # (-)
#				                                                                                         <--|||||¦||||||||||¦|||||
#				                                                                                         3'-TTCAGYATTGTTCCATYGGCAT-5'
#
...

Probe (with JSON):

# With primers + probe described by Parker et al. (2017); DOI: 10.1371/journal.pone.0173422
ipcr-probe \
  -f TCTAATTTTTTCATCATCGCTAATGC -r TCAGGCCTTTGCTACAATGAAC -P AACTGCATCATATCACATACT \
  --circular \
  --output json \
  Mycoplasmopsis-bovis.fna.gz
[
  {
    "experiment_id": "manual",
    "sequence_id": "NC_014760.1",
    "start": 353221,
    "end": 353333,
    "length": 112,
    "type": "revcomp",
    "seq": "TCAGGCCTTTGCTACAATGAACTTATTTTTAACTAACGCAAATAAAACATATAGTATGTGATATGATGCAGTTTTAAATAATAAGAGCATTAGCGATGATGAAAAAATTAGA",
    "source_file": "Mycoplasmopsis-bovis.fna.gz",
    "probe_name": "probe",
    "probe_seq": "AACTGCATCATATCACATACT",
    "probe_found": true,
    "probe_strand": "-",
    "probe_pos": 52,
    "probe_site": "AGTATGTGATATGATGCAGTT"
  }
]

Nested PCR (outer TSV, inner TSV):

# With external and internal primers described by Figuero et al. (2011); DOI: 10.1902/jop.2011.100719
ipcr-nested \
  --outer-primers 27F-1492R.tsv \
  --inner-primers Fn_nested-primers.tsv \
  --output text \
  --mismatches 1 \
  --sort \
  Fusobacterium-nucleatum.fna.gz
source_file	sequence_id	outer_experiment_id	outer_start	outer_end	outer_length	outer_type	inner_experiment_id	inner_found	inner_start	inner_end	inner_length	inner_type	inner_fwd_mm	inner_rev_mm
Fusobacterium-nucleatum.fna.gz	NZ_CP028101.1	outer	534786	536270	1484	forward	Fn-F517-R1214	true	541	1237	696	forward	0	0
Fusobacterium-nucleatum.fna.gz	NZ_CP028101.1	outer	613679	615163	1484	forward	Fn-F517-R1214	true	541	1237	696	forward	0	0
Fusobacterium-nucleatum.fna.gz	NZ_CP028101.1	outer	1079673	1081157	1484	forward	Fn-F517-R1214	true	541	1237	696	forward	0	0
Fusobacterium-nucleatum.fna.gz	NZ_CP028101.1	outer	335297	336781	1484	revcomp	Fn-F517-R1214	true	247	943	696	revcomp	0	0
Fusobacterium-nucleatum.fna.gz	NZ_CP028101.1	outer	2054505	2055989	1484	revcomp	Fn-F517-R1214	true	247	943	696	revcomp	0	0

Multiplex panel (TSV of many pairs):

# With multiplex primer pool described by Park and Ricke (2015); DOI: 10.1111/jam.12678
ipcr-multiplex \
  --primers multiplex-pcr-assay.tsv \
  --output jsonl \
  --products \
  --sort \
  Salmonella-Typhimurium.fna.gz
{
  "experiment_id": "ST",
  "sequence_id": "NC_003197.2",
  "start": 4750875,
  "end": 4751186,
  "length": 311,
  "type": "revcomp",
  "seq": "ATGACAAACTCTTGATTCTGAAGATCGACTTTTTTTGCTATGTAATCCGCGATCTTTTTCTGATTCAATAAGCCAACGAGTTGTTTTTTCAGCGCTTCGGTACCGACTTTCACTTCCTGCTGACAGACGCGGTCAAATAACCCACGTTCAGTGAGCATGTCGACGATGATCTGAAAGATGTTGAGGTGCGCGAACTTGTGGTCCTTTTCCAGATTACGCAACAGATACTTCAGGTGTTCACGCACCTGCAGCTCATTCTGAGCAGGATAATCAAAAATCCAGAACCCAATCTCATTACCGGAGCCGTTGTT",
  "source_file": "S-typhimurium.fna.gz"
}

Thermodynamically informed ranking:

# With multiplex primer pool described by Xiong (2017); DOI: 10.3389/fmicb.2017.00420
ipcr-thermo \
  --oligo ATGTCTATAAGCACCACAATG         --oligo TCATTTCAATAATGATTCAAGC \
  --oligo CATTCTGACCTTTAAGCCGGTCAATGAG  --oligo CCAAAAAGCGAGACCTCAAACTTACTCAG \
  --oligo GCGGACGTCATTGTCACTAACCCGACG   --oligo TCTAAAGTGGGAACCCGATGTTCAGCG \
  --mismatches 3 --circular \
  Salmonella-Enteritidis.fna.gz
source_file	sequence_id	experiment_id	start	end	length	type	fwd_mm	rev_mm	fwd_mm_i	rev_mm_i	score
Salmonella-Enteritidis	NZ_CP025559.1	O3+O4	2446500	2446839	339	revcomp	0	0	-110.73864769266693
Salmonella-Enteritidis	NZ_CP025559.1	O5+O6	2734882	2735037	155	revcomp	0	0	-120.79822631649216
Salmonella-Enteritidis	NZ_CP025559.1	O1+O2	1853303	1854185	882	revcomp	0	0	-137.31230787351492

Thermodynamic scoring scope

ipcr-thermo has multiple thermodynamic implementation modes and empirical score profiles. Use the mode/profile labels in output metadata rather than treating all scores as one universal scale.

Common modes and profiles:

Setting Meaning
legacy-heuristic Historical compatibility path; not the default for new releases.
nn-duplex-v1 Nearest-neighbor primer-template duplex scoring.
nn-structure-v1 NN duplex scoring plus primer hairpin/dimer competition. Default thermo model.
binding Primer-template binding rank.
pcr Binding plus extension and length proxy.
gel PCR proxy plus band-mass proxy.

The pcr and gel profiles are useful empirical rankers, but they are not full polymerase kinetics or quantitative gel-intensity models. Modified probes such as MGB probes are not fully calibrated; use --probe-score-mode annotate or --probe-thermo=false unless a calibrated modifier model is available.

See docs/THERMO_MODELS.md for the model matrix and fallback labels, and docs/THERMO_RELEASE_CHECKLIST.md for release/smoke-test guidance.

Inputs

  • Inline primers: -f/--forward, -r/--reverse (5′→3′; IUPAC allowed).

  • TSV primers (panel file):

    id  FORWARD_PRIMER  REVERSE_PRIMER  [min_len]  [max_len]
    

    Optional per-pair min_len/max_len override global bounds.

  • FASTA: Positional paths/globs. Use - for stdin. gz is auto-detected. (Also accepts --sequences FILE[.gz] (repeatable), soon to be deprecated)


Performance & streaming

  • Threads: --threads N (0 = all CPUs).

  • Chunking: --chunk-size N splits records into rolling windows; overlap is chosen safely from max(effective_max_product_len, primer_len-1) so boundary hits survive. TSV per-pair max_len overrides are included in the effective maximum.

    • Chunked mode streams each FASTA record as it is read; unchunked mode emits whole records and therefore buffers each record until the next header/EOF.
    • If --circular, chunking is disabled when a positive --chunk-size is requested.
    • If the effective max product length is unbounded or --chunk-size <= effective_max_product_len, chunking auto-disables with a warning.
  • Seeding: primer panels are compiled once per run into a compact A/C/G/T Aho–Corasick seed automaton. Exact scans use concrete seed patterns; mismatch-tolerant scans use approximate seed neighborhoods and then re-check every candidate with the full primer/IUPAC/terminal-window verifier. Duplicate seed patterns share payloads across primer pairs/orientations. Genome N and other non-ACGT bytes reset the automaton; with mismatches enabled, local non-ACGT halos are verified directly so reference N remains a hard mismatch without creating seed false negatives. Highly degenerate seed neighborhoods that exceed the expansion cap fall back per orientation. See Performance validation for local benchmark commands.

  • Cancelable I/O: FASTA scanners honor context; Ctrl-C exits with 130.


Flags you’ll actually use

  • --mismatches N — max mismatches per primer (default 0)
  • --terminal-window N — no mismatches allowed in the last N bases (3 nt by default in realistic mode)
  • --min-length / --max-length — product length bounds
  • --circular — permit wrap-around amplicons
  • --output text|json|jsonl|fasta — choose format; --sort for stable order; --products to emit sequences in text/json
  • --pretty — ASCII alignment blocks (text)
  • --self=true|false — include single-oligo amplification (A×rc(A), B×rc(B)) (default true)

Citation

If you use ipcr, please cite the archived software release:

https://doi.org/10.5281/zenodo.20232919


About

Fast in-silico PCR toolkit for primer/probe-supported amplicon discovery with IUPAC-aware matching and thermodynamic ranking.

Topics

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages