Migrated trrosetta and rhofold shs evaluation - #5
Open
scheuerdo wants to merge 2 commits into
Open
Conversation
There was a problem hiding this comment.
🔵 Needs a closer look
It adds a very large amount of dataset content directly to git, which can have significant repository-size and CI/operational impact and should be validated by a human reviewer.
Pull request overview
This PR migrates the input datasets used for trRosetta/RhoFold SHS evaluation into the repository by adding many prepared RNA sequence files (FASTA) and MSA inputs (A3M) across multiple dataset variants (e.g., spotRNA, RNAfold, RNAformer, denoised monomers).
Changes:
- Add prepared SHS input FASTA files for multiple upstream sources (spotRNA/RNAfold/RNAformer and monomer-denoise variants).
- Add prepared DB MSA inputs as both FASTA and A3M (query + alignments where available).
- Add prepared “MSA + SHS” input datasets for RNAformerN100.
File summaries
| File | Description |
|---|---|
| tr_rhofold_shs_eval/prepared_shs_inputs_from_spotrna_folder/fasta/* | Adds spotRNA-derived SHS evaluation FASTA inputs. |
| tr_rhofold_shs_eval/prepared_shs_inputs_from_rnaformerN100_folder/fasta/* | Adds RNAformerN100-derived SHS evaluation FASTA inputs. |
| tr_rhofold_shs_eval/prepared_shs_inputs_from_rnafold_folder/fasta/* | Adds RNAfold-derived SHS evaluation FASTA inputs. |
| tr_rhofold_shs_eval/prepared_shs_inputs_from_rna_monomers_spotrna_denoise_folder/fasta/* | Adds denoised monomer FASTA inputs derived from spotRNA. |
| tr_rhofold_shs_eval/prepared_shs_inputs_from_rna_monomers_rnafold_denoise_folder/fasta/* | Adds denoised monomer FASTA inputs derived from RNAfold. |
| tr_rhofold_shs_eval/prepared_shs_inputs_from_rna_monomers_dssrN100_folder/fasta/* | Adds DSSR N100 monomer FASTA inputs for evaluation. |
| tr_rhofold_shs_eval/prepared_msa_plus_shs_from_rnaformerN100_folder/fasta/* | Adds RNAformerN100 “MSA + SHS” FASTA inputs. |
| tr_rhofold_shs_eval/prepared_db_msa_inputs/fasta/* | Adds FASTA inputs used as query sequences for DB MSA preparation. |
| tr_rhofold_shs_eval/prepared_db_msa_inputs/a3m/* | Adds A3M MSA outputs (query plus alignments when available). |
Review details
- Files reviewed: 209/1789 changed files
- Comments generated: 1
- Review effort level: Lite
💡 Add a code-review agent skill or configure MCP servers for context-aware, tailored reviews. Learn more in the docs.
Comment on lines
+1
to
+2
| >9DE8 | ||
| GGUCUCUCUGGUUAAGCCAGAUCUGAGCCGAAAAGCUCUCUGGCUAACUAGGGAAC |
The folder carried settings from the cluster it was run on: - envs/*.yml ended with a `prefix:` line pointing at a personal conda env path (conda ignores it on `env create`, so nothing is lost). - The `json_file` column of every prepared_*/metadata manifest held absolute workspace paths; they are now relative to the repo (../data/datafiles/...) or to this folder (./...), keeping the provenance without the machine. - Three job scripts had a disabled --mail-user with a real address, now a placeholder. The remaining site-specific settings (SLURM partitions, CUDA module, GPU types, conda env names, walltimes) are part of how the jobs run, so README section 1.5 documents each one and how to override it instead. Co-Authored-By: Claude Opus 5 <noreply@anthropic.com> Claude-Session: https://claude.ai/code/session_01Fjk8bfcYyYrUY6xcfn2yFd
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Add this suggestion to a batch that can be applied as a single commit.This suggestion is invalid because no changes were made to the code.Suggestions cannot be applied while the pull request is closed.Suggestions cannot be applied while viewing a subset of changes.Only one suggestion per line can be applied in a batch.Add this suggestion to a batch that can be applied as a single commit.Applying suggestions on deleted lines is not supported.You must change the existing code in this line in order to create a valid suggestion.Outdated suggestions cannot be applied.This suggestion has been applied or marked resolved.Suggestions cannot be applied from pending reviews.Suggestions cannot be applied on multi-line comments.Suggestions cannot be applied while the pull request is queued to merge.Suggestion cannot be applied right now. Please check back later.
No description provided.