Is it possible to show only the nonconserved residues of the sequence alignment with the exception of the reference sequence (mostly the first one)? All conserved residues could than be shown with a special character, typically a dot. Example:
ref GGGGAACTTCTCCTGCTAGAAT
2 GGG...................
3 .................A....
4 ...................A..
5 ..........T........A..
Is it possible to show only the nonconserved residues of the sequence alignment with the exception of the reference sequence (mostly the first one)? All conserved residues could than be shown with a special character, typically a dot. Example: